Главная » Новости » Природа

Шесть тайн тропических лесов, озадачивших ученых

дата добавления 17 Апреля 2023
Просмотры 3934
комментарии 3

Каждый год ученые отправляются исследовать тропические леса и находят там десятки новых видов растений и животных, сталкиваясь попутно со множеством загадок.

Совершенно нетронутый лес в Мозамбике

В 2012 году доктор Джулиан Бейлисс - эксперт по бабочкам с помощью карт Google Earth обнаружил на территории Мозамбика (Юго-Восточная Африка) совершенно неизвестный и нетронутый человеком кусок тропического леса.

Этот лес рос в кратере давно потухшего вулкана и отвесные стены кратера и его высота очевидно послужили лесу надежной защитой от браконьеров. 

Ученые были шокированы данным открытием, но отнеслись к нему очень скептически. Лишь пять лес спустя Бейлиссу удалось собрать команду из 28 человек, чтобы поехать в Мозамбик и на месте изучить найденный лес. 

Подобравшись к кратеру, они поняли, почему лес оказался нетронутым, стены кратера были совершенно неприступными для человека. Забраться туда можно было разве что с помощью специального альпинистского оборудования, которого они с собой не прихватили.

Команде пришлось использовать беспилотники, с помощью которых они все-таки обнаружили в одном месте лазейку, где можно было подняться. Когда они наконец оказались в лесу, они тут же открыли там несколько новых видов бабочек.

А еще, что было еще более неожиданным, они нашли тут следы присутствия человека. Это были глиняные горшки, которые валялись среди деревьев.  Команда предположила, что они были оставлены тут в качестве подношений богам.

При этом горшки выглядели так, словно им было по меньшей мере несколько тысяч лет. И никто из ученых не знал о том, какие группы людей жили в этих местах в ту эпоху.

Наскальные рисунки Амазонки с изображением древних животных

Южная Америка начала заселяться людьми примерно 12 тысяч лет назад и ученым почти ничего не известно об этих ранних группах. Основная проблема состоит в том, что там невозможно вести стандартные археологические раскопки из-за лесов, труднодоступности мест и огромной влажной экосистемы Амазонки.

Но в 2017 году случилось чудо. В глуши колумбийских джунглей был случайно обнаружен участок скал, покрытый древними наскальными изображениями, протянувшийся почти на 13 км.  Считается, что этим изображениям по меньшей мере несколько тысяч лет и на них можно обнаружить фигуры таких вымерших животных как мастодонты (древние слоны), мегатерии (гигантские ленивцы), огромные птицы и тд. 

Особенно примечательно изображение, предположительно, мегатерия рядом с группой крошечных человечков. Выглядит это так, как будто животное пытается напасть на людей.

 

"Картины дают яркий и захватывающий взгляд на жизнь этих сообществ. Для нас сегодня невероятно думать, что они жили среди гигантских травоядных животных и охотились на них, а некоторые из них были размером с небольшой автомобиль", - говорит археолог Марк Робинсон.

Тайна мапингуари

Некоторые амазонские туземцы уверены в том, что в джунглях обитает страшный зверь с огромными когтями, которого они зовут мапингуари. Хотя биологи настроены скептично, по описаниям это существо больше всего напоминает вымершего ленивца мегатерия. 

На протяжении веков мапингуари были ключевой частью легенд и песен, передаваемых между племенами. Согласно этим источникам, в высоту мапингуари достигает около 2 метров, у него спутанная шерсть и он крайне неприятно пахнет. 

Некоторые охотники заверяли, что лично видели это существо и что у него всего один глаз, а в районе животе вторая пасть с острыми зубами.  Несмотря на то, что мегатерии были травоядными, мапингуари считают очень агрессивным по отношению к людям. Правда в основном к тем, кто "неуважительно" относится к лесу. 

К сожалению, ученые не смогли найти доказательств того, что гигантское существо, похожее на ленивца, действительно все еще живет где-то на Амазонке. И это не из-за недостатка попыток. Биологи на самом деле потратили значительное время на поиски костей и экскрементов в отдаленных районах тропического леса, но ничего не нашли.

Не имея на руках веских доказательств, они думают, что все эти истории основаны лишь на том, что когда-то давно предки туземцев сталкивались с мегатериями и ужас перед этими созданиями передавался в легендах от поколения к поколению.

"Мне совершенно ясно, что легенда о мапингуари основана на человеческом контакте с последними из наземных гигантских ленивцев. Мы знаем, что вымершие виды могут сохраняться как легенды в фольклоре в течение сотен лет", - считает ученый Дэвид Орен.

Палеонтологи находят на Амазонке немало костей мегатериев, которые вымерли в конце последнего ледникового периода. Но кто знает, может некоторое количество этих животных в самом деле все еще бродят по джунглям Амазонки? Может быть они просто настолько редки, что их кал и следы не так просто отыскать.

Подробнее о мапингуари можно прочитать в статье "Вонючий мапингуари - ужас Амазонии".

Мертвый кит в джунглях Амазонки

Горбатые киты за свою жизнь преодолевают тысячи миль. Одно из их самых больших путешествий приходится на лето, когда они плывут на юг к океанам Антарктиды из северного полушария. Но ученые были шокированы, когда в феврале 2019 года молодой горбатый кит был найден мертвым на берегу островка Марахо на реке Амазонка. 

Обнаружения кита здесь было странным по нескольким причинам. Во-первых, в такое время горбатые киты в Амазонку не заплывают. Они посещают теплые амазонские воды лишь в декабре, а к февралю давным давно уплывают из этого региона. То есть время его гибели не соответствовало известным схемам миграции горбатых китов. 

Во-вторых, кит был найден выше по течению от впадения реки в Атлантический океан и в том месте была пресная вода, что сбило биологов с толку. В третьих, у животного не было никаких видимых ран, так что браконьерство и китобойный промысел были исключены. 

Одна из предложенных теорий предполагала, что молодой кит, предположительно в возрасте 1 года, случайно потерялся от матери в начале миграции. В дальнейшем сильные течения унесли его в устье реки и там он потерялся в мангровых болотах. Там он еще больше ослабел и в итоге погиб в пресноводной среде.

Была также предложена гипотеза, что кит мог проглотить пластиковые отходы вблизи берега, что ускорило его гибель. 

Как бы то ни было, для местных жителей было неслыханно видеть кита так далеко вверх по реке. И хотя ученые считают, что вышеназванные две теории могут быть вероятным сценарием, они все еще не уверены в том, что тут произошло.

Сложные паутинные структуры в Перу

Известно, что пауки сооружают паутину всевозможных узоров, но в тропических лесах Перу были обнаружены уникальные "шелковые" структуры, назначение которых ученым до сих пор непонятно и даже все еще точно неизвестно, кто их создает.

Это открытие было сделано в 2013 году и невероятно сложный дизайн этих паутин с тех пор очаровывает энтомологов. Англоязычные ученые тут же прозвали их "Силкхенджами" от слов "силк" (шелк) и Стоунхендж - древняя круговая мегалитическая постройка в Англии.

В 2019 году энтомолог Фил Торрес впервые заснял эти паутинные шедевры на видео и заявил, что они созданы пока еще не обнаруженным видом паука для сохранения кладки яиц. Потому что они заметили, что из некоторых структур вылезают крошечные паучки. 

Однако по сей день никому из ученых так и не удалось заснять процесс того, как паук плетет "Силкхендж" и какой именно паук это делает.

Кипящая река Маянтуяку

Отдаленный городок Пукальпа в центральной части Перу находится недалеко от одного из самых интересных и загадочных мест на Амазонке. Крошечный городок расположен на берегу "кипящей" реки, которая, как говорят, убивает все, что в нее попадает. 

В реке Маянтуяку круглый год очень высокая температура.  Согласно измерениям ученых, она находится в диапазоне от +38°C до +93°C. В нет ничего живого.  Ее длина составляет 6,4 километра, а максимальная глубина 4,9 метра.  Люди, которые падали в эти воды, получали ожоги третьей степени в течение нескольких секунд. 

Туристам рекомендуется держаться подальше от воды, чтобы избежать серьезных травм или смерти. При этом река считается священной. Местный шаман утверждает, что ее вода полезна для лечения.

Отчего вода настолько горяча? Ученые пока не знает ответа. В 2011 году сюда приезжал перуанский геолог Андрес Рузо, который и "открыл" эту реку для всего остального мира. Он замерял температуру в реке и она в среднем показала +86 °C. Хотя речная вода не кипит как вода в чайнике, она без сомнений является смертельной ловушкой для всего живого. 

Рузо был сбит с толку тем, почему река была такой горячей, потому что, по его словам, рядом нет никакой вулканической активности.  Предполагается, что где-то на глубине в реку выходят горячие источники, что сильно нагревают остальную воду. Но из-за высокой температуры провести подводные исследования невозможно. 

наскальные рисунки, перу, паутина, кит, тропики, река, тропические леса
Если вы видели что-то необычное, пришлите историю нам через форму обратной связи или на адрес newsparanormal@yandex.ru и мы опубликуем ее на этом сайте.
       


СВЕЖЕЕ В НОВОСТЯХ И БЛОГАХ
КОММЕНТАРИИ (3)       ПРЕДЫДУЩИЕ КОММЕНТАРИИ 🡺
avatar
0
3 valcan555 08:44, 23 Апреля 2023
В 2016 году пару человек при поддержке турфирмы Tropical Herping побывали в Yasuni National Park, Ecuador. Взяли одного паучка (02:39 https://www.youtube.com/watch?v=Unc-g9AHl2Y&t=3s ).
Он говорит, что "три года назад (2013) нашли эту странную структуру (нашёл Трой Александр), только два года назад (2014), мы обнаружили, что это делает паук, но всё ещё загадка зачем это ограждение, зачем эта башня в середине. "
Они сняли на Canon 70D видео, что в "башне" находится кладка, а ограждение они предполагают для разных непрошеных гостей, которые также могут стать и едой для молодняка.
Они взяли паучка и отослали в канадский центр DNA barcoding.
Вот сюда: https://blast.ncbi.nlm.nih.gov
Они получили ответ, DNA barcode sequence:
GACTTTATATTTGTTATTTGGAGTATGGGCTGCTATAGTTGGGACTGCAATAAGAGTATTA
ATTCGAGTTGAGTTAGGGCAACCAGGAAGATTATTAGGGGATGATCAACTATATAATGTA
ATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCAATTTTAATTGGGGG
ATTTGGAAATTGATTAATTCCTATAATGTTAGGAGTACCTGATATAGCTTTTCCTCGGATA
AATAATCTTAGTTTTTGATTATTACCCCCTTCTTTGTTTTTACTTTTAATTTCTTCTTTAAAT
GAAATAGGAGTTGGGGCTGGGTGAACAGTATACCCTCCTTTATCTTCTTTGGAAGGTCA
TAATAATAGATCTATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCATCTTCAATTAT
GGGAGCAATTAATTTTATTACTACAATTATAAATATACGGAGAGTAGAATTTAAAATAGAAA
ATATTTCTTTATTTATTTGATCTGTTTTAATTACAGCAGTACTTTTATTATTGTCTTTACCTG
TATTAGCAGGTGCTATTACTATATTATTAACAGATCGTAATTTTAATACATCTTTTTTTGATC
CTTCTGGAGGAGGGGACCCTGTTTTATTTCAACATTTATTT
но совпадение с известными образцами было только 86%. Это значит, что либо это совершенно новый вид паука, либо DNA этого вида пауков не было в базе данных.
avatar
0
1 Nocturna 01:50, 18 Апреля 2023
Лол если они видели как мелкие паучки покидают гнездо этого "стоунхенджа" из паутины - почему паучков не забрали на анализ? выкормить и пусть вырастут в тот вид который это плетёт) В смысле не знают какой паук это делает если видели как паучата вылупляются?! оО дурдом какой-то) Они конечно хрупкие но уж кто-то да выживет, друг друга сожрут по пути, да и всякую всячину можно им в резервуар кидать съедобную, чтобы вывести и узнать что за вид такой. Шелкопрядов же содержат некоторые на фермах, и любители экзотики всяких тарантулов выводят даже в домашних условиях.
avatar
0
2 Fox 10:35, 18 Апреля 2023
Если я правильно понял, там им можно было только снимать, а нельзя было вмешиваться в экосистему и забирать с собой насекомых.
avatar